si:dkey-19n13.4

Ensembl ID:
ENSDARG00000076058
ZFIN ID:
ZDB-GENE-100922-270
Human Orthologues:
GBA, GBAP1
Human Descriptions:
glucosidase, beta, acid pseudogene 1 [Source:HGNC Symbol;Acc:4178]
glucosidase, beta, acid [Source:HGNC Symbol;Acc:4177]
Mouse Orthologue:
Gba
Mouse Description:
glucosidase, beta, acid Gene [Source:MGI Symbol;Acc:MGI:95665]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1621 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113093 Essential Splice Site 178 518 4 10

The following transcripts of ENSDARG00000076058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 15985427)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14330319
KASP Assay ID:
554-1562.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTACGATCTCCAGAACTTCACCCTGGCCAAAGAGGATGTTCACATGAAG[G/A]TAGCATACACAAACAAAAACACACCTTRCTACAAATAGCGGTCTGCAGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link