si:ch211-149p5.1

Ensembl ID:
ENSDARG00000076044
ZFIN ID:
ZDB-GENE-070705-41
Description:
Novel protein similar to vertebrate thyrotropin-releasing hormone degrading ectoenzyme (TRHDE) [Sour
Human Orthologue:
TRHDE
Human Description:
thyrotropin-releasing hormone degrading enzyme [Source:HGNC Symbol;Acc:30748]
Mouse Orthologue:
Trhde
Mouse Description:
TRH-degrading enzyme Gene [Source:MGI Symbol;Acc:MGI:2384311]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40298 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112301 Essential Splice Site 364 994 3 19
ENSDART00000133056 Essential Splice Site 364 947 3 18
Genomic Location (Zv9):
Chromosome 4 (position 22178646)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23521981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTTTACCAGGATTACTTCAAAGTCAAATATTCCCTCCCCAAATTAGG[T/C]AAGCCGGCCGGTGAAATGTCTTCATCTTTATCTGGCTTCAGTGACGCTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link