si:dkey-174n5.3

Ensembl ID:
ENSDARG00000076041
ZFIN ID:
ZDB-GENE-091118-8
Human Orthologue:
WWC1
Human Description:
WW and C2 domain containing 1 [Source:HGNC Symbol;Acc:29435]
Mouse Orthologue:
Wwc1
Mouse Description:
WW, C2 and coiled-coil domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2388637]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15129 Nonsense Available for shipment Available now
sa6681 Nonsense Mutation detected in F1 DNA During 2017
sa37356 Nonsense Mutation detected in F1 DNA During 2017
sa24002 Nonsense Available for shipment Available now
sa14794 Essential Splice Site Available for shipment Available now
sa3113 Nonsense F2 line generated During 2017
sa12581 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113678 Nonsense 63 1112 2 22
ENSDART00000138129 Nonsense 63 1129 2 22
Genomic Location (Zv9):
Chromosome 21 (position 35867594)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36860842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCYGACTGTATTGGAGATGAGCTGCCTGTGGGATGGGAGGAGGCCTA[C/A]GACCCCCAYGTCGGAGCCTATTATGTCGACCACAACACCAGTAAGTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113678 Nonsense 99 1112 3 22
ENSDART00000138129 Nonsense 99 1129 3 22
Genomic Location (Zv9):
Chromosome 21 (position 35865580)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36858828
KASP Assay ID:
554-5197.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCCGCGGGCTCAGTGGCAGCGGGAACAGGAGCTTATGTTGCACGATTA[T/A]CTGAATGTGGTTCAGGAAGCACTGAGTGCCCAAAAGGAGATCTACCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113678 Nonsense 145 1112 4 22
ENSDART00000138129 Nonsense 145 1129 4 22
Genomic Location (Zv9):
Chromosome 21 (position 35860623)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36853871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGTTATACAGATAAGATAAAGCCTTTGAACTCTTATCTTCCCTACAG[T/G]AAATTCCAGATCCTCATCAAGCAGTAAATATGACCCTGAAATCCTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113678 Nonsense 178 1112 5 22
ENSDART00000138129 Nonsense 178 1129 5 22
Genomic Location (Zv9):
Chromosome 21 (position 35860313)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36853561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTCTGTTGCTGTCTTTTGTTCAGGTAAATAAGCTGAAGAGAGATT[T/A]GGCCTATATGAAGCAAGAACTGCATTATAAGGAGCAAGGCTTTGAGACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113678 Essential Splice Site 197 1112 5 22
ENSDART00000138129 Essential Splice Site 197 1129 5 22
Genomic Location (Zv9):
Chromosome 21 (position 35860254)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36853502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGCAAGAACTGCAKTATAAGGAGCAAGGCTTTGAGACGTTGAAAGAG[T/C]AAGTGTAACCTGACCTAWATTGCACGATCACGTTCCAGACAACCGATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3113
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113678 Nonsense 753 1112 14 22
ENSDART00000138129 Nonsense 741 1129 14 22
Genomic Location (Zv9):
Chromosome 21 (position 35811266)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36804514
KASP Assay ID:
554-2545.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGTTAAAGGAAGCGTTTAGCCTGCAGGTGTCCTCCACTGCTCTCCGA[C/T]AGAAGACCCTGCGMATTGATGTCTGCACCACCAGCAAATCAGRCCGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113678 Essential Splice Site 819 1112 15 22
ENSDART00000138129 Essential Splice Site 807 1129 15 22
Genomic Location (Zv9):
Chromosome 21 (position 35807940)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36801188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGATGGAAAGCAAAAAGAAACWGAGATGCCCGCTCTGCAGGARCTGG[T/A]AAAGTATTAACACAAATACACACTCCTCAATTCACTTTACTTCACCACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link