cacnb3b

Ensembl ID:
ENSDARG00000076030
ZFIN ID:
ZDB-GENE-090127-1
Description:
Voltage-dependent calcium channel beta 3b subunit [Source:UniProtKB/TrEMBL;Acc:A2SZ56]
Human Orthologue:
CACNB3
Human Description:
calcium channel, voltage-dependent, beta 3 subunit [Source:HGNC Symbol;Acc:1403]
Mouse Orthologue:
Cacnb3
Mouse Description:
calcium channel, voltage-dependent, beta 3 subunit Gene [Source:MGI Symbol;Acc:MGI:103307]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7508 Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113796 Missense 47 332 2 11
ENSDART00000115141 Missense 89 375 3 12
Genomic Location (Zv9):
Chromosome 23 (position 27189506)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27022328
KASP Assay ID:
554-4191.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGAACATACTGTCTCTTGCTCTACAGAAGTATAATAATGACTGGTGG[A/T]TCGGGAGGCTGGTGAAGGAGGGGGCAGATATTGCCTTCATCCCCAGCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link