sez6l

Ensembl ID:
ENSDARG00000076028
ZFIN ID:
ZDB-GENE-091204-162
Human Orthologue:
SEZ6L
Human Description:
seizure related 6 homolog (mouse)-like [Source:HGNC Symbol;Acc:10763]
Mouse Orthologue:
Sez6l
Mouse Description:
seizure related 6 homolog like Gene [Source:MGI Symbol;Acc:MGI:1935121]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21892 Essential Splice Site Available for shipment Available now
sa12945 Essential Splice Site Available for shipment Available now
sa12754 Essential Splice Site Available for shipment Available now
sa9202 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21892
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114839 Essential Splice Site 414 937 6 17
ENSDART00000141454 Essential Splice Site 232 755 4 15
Genomic Location (Zv9):
Chromosome 11 (position 21621953)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44803733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGGCTGCACCTACACCTGGAGAGAATGGTGTTGGGCACCACAGACAGG[T/G]AAACCCAGGTACCATCAACATCAATGCATGCTTCTCCTACGACAGCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114839 Essential Splice Site 470 937 7 17
ENSDART00000141454 Essential Splice Site 288 755 5 15
Genomic Location (Zv9):
Chromosome 11 (position 21621314)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44804372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGACCAGCCGAACAGCCACAACACCGGCTTCAATATACGATTTGAAG[G/A]YAGGCTGACAATGCACCGAGTAGATTCAATTCAATGTGCAATGGACTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114839 Essential Splice Site 471 937 7 17
ENSDART00000141454 Essential Splice Site 289 755 5 15
ENSDART00000114839 Essential Splice Site 471 937 7 17
ENSDART00000141454 Essential Splice Site 289 755 5 15
Genomic Location (Zv9):
Chromosome 11 (position 21621313)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44804373
KASP Assay ID:
2260-4199.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGACCAGCCGAACAGCCACAACACCGGCTTCAATATACGATTTGAAGR[T/C]AGGCTGACAATGCACCGAGTAGATTCAATTCAATGTGCAATGGACTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114839 Essential Splice Site 471 937 7 17
ENSDART00000141454 Essential Splice Site 289 755 5 15
ENSDART00000114839 Essential Splice Site 471 937 7 17
ENSDART00000141454 Essential Splice Site 289 755 5 15
Genomic Location (Zv9):
Chromosome 11 (position 21621313)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44804373
KASP Assay ID:
2260-4199.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGACCAGCCGAACAGCCACAACACCGGCTTCAATATACGATTTGAAGG[T/C]AGGCTGACAATGCACCGAGTAGATTCAATTCAATGTGCAATGGACTAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link