kif5c

Ensembl ID:
ENSDARG00000076027
ZFIN ID:
ZDB-GENE-081105-14
Description:
kinesin heavy chain isoform 5C [Source:RefSeq peptide;Acc:NP_001116747]
Human Orthologue:
KIF5C
Human Description:
kinesin family member 5C [Source:HGNC Symbol;Acc:6325]
Mouse Orthologue:
Kif5c
Mouse Description:
kinesin family member 5C Gene [Source:MGI Symbol;Acc:MGI:1098269]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34632 Nonsense Mutation detected in F1 DNA During 2016
sa21480 Nonsense Available for shipment Available now
sa8541 Nonsense Available for shipment Available now
sa9450 Nonsense Available for shipment Available now
sa5538 Nonsense F2 line generated During 2016
sa38739 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083567 Nonsense 199 985 8 25
Genomic Location (Zv9):
Chromosome 9 (position 24236702)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23392488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCATCTTGACTTGTTCTCTGATGTTACATTGTGTTACAGACATGAAT[G/T]AGCACAGCTCCCGCAGTCACAGCATTTTCCTCATTAATATTAAGCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083567 Nonsense 342 985 11 25
Genomic Location (Zv9):
Chromosome 9 (position 24235554)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23391340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCAAAAACACAGTTTCTGTTAACATGGAGCTCACAGCTGAGGAATGG[A/T]AGAAGAAATATGAGAAGGAGAAAGAGAAAACCAGAAATCTGAAGATCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083567 Nonsense 368 985 11 25
ENSDART00000083567 Nonsense 368 985 11 25
Genomic Location (Zv9):
Chromosome 9 (position 24235476)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23391262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCAGAAATCTGAAGATCATCATCCAGCGCCTAGAAAATGAGCTCAAA[C/T]GATGGAGRAAAGGTAACAAAAACCACACATTCTGTGCCATGATTTACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083567 Nonsense 368 985 11 25
ENSDART00000083567 Nonsense 368 985 11 25
Genomic Location (Zv9):
Chromosome 9 (position 24235476)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23391262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCAGAAATCTGAAGATCATCATCCAGCGCCTAGAAAATGAGCTCAAA[C/T]GATGGAGRAAAGGTAACAAAAACCACACATTCTGTGCCATGATTTACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5538
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083567 Nonsense 646 985 17 25
Genomic Location (Zv9):
Chromosome 9 (position 24222867)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23378653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGCATCAAGCAAAGATCAAATCCCTCACAGACTACATGCAGAACATG[G/T]AACAGAAGAAGAGACAGCTGGAGGAAAGCCATGATTCACTGACAGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083567 Nonsense 947 985 25 25
Genomic Location (Zv9):
Chromosome 9 (position 24219079)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23374865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTGCTTCTCCGGGTCACAGTGTGAGAGGAGGCACGCCAAGCCCCAGA[C/T]GACACCACCAACACCAACCACATCACCACCAACAACCACCCCAACCACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link