DGKZ (2 of 2)

Ensembl ID:
ENSDARG00000076025
Description:
diacylglycerol kinase, zeta 104kDa [Source:HGNC Symbol;Acc:2857]
Human Orthologue:
DGKZ
Human Description:
diacylglycerol kinase, zeta 104kDa [Source:HGNC Symbol;Acc:2857]
Mouse Orthologue:
Dgkz
Mouse Description:
diacylglycerol kinase zeta Gene [Source:MGI Symbol;Acc:MGI:1278339]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10033 Nonsense Available for shipment Available now
sa38004 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24608 Essential Splice Site Available for shipment Available now
sa38005 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44233 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9720 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Nonsense 24 1107 1 35
Genomic Location (Zv9):
Chromosome 25 (position 8068736)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7681260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCATTTTAAGAGAAAGGAAGCAGGGGACGGTGTGCATGATGACTCCTGT[C/T]GACACCGGAGRCCGAGCATTGCAGTGCCAACCAGCCGTGCCCGACGGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Essential Splice Site 258 1107 5 35
Genomic Location (Zv9):
Chromosome 25 (position 8078174)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7690698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTAAAAGTGAACCCAACAAAAAGATATGCAACACCGTGGATTGGACC[G/A]TGAGTTACTCGTCTGTATTTTACCAACAAGTAGGCCTGTCACAATAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Essential Splice Site 610 1107 17 35
Genomic Location (Zv9):
Chromosome 25 (position 8097361)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7709885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATTTAGAGGCCAGCGATGAGGACAAAGATGAACAACAGACCGACAAG[G/T]TGAGCTGACACCAGCAGAGGGCGCAAGACTTTAGCAGAAGAACATCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Essential Splice Site 637 1107 19 35
Genomic Location (Zv9):
Chromosome 25 (position 8098693)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7711217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGTTTGTTAAAGGCTTCAGATCTTTTAAGATGCCGTTTTGTTATTTC[A/G]GAGGCTAAACCGGAACGCTTCAACAGTCGACTTCGCAATAAGATGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Essential Splice Site 865 1107 25 35
Genomic Location (Zv9):
Chromosome 25 (position 8108108)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7720632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACAGTGATTTGGAGACGTGTCGGCAGCATATCGAGAGGTTGCATGAG[G/T]TGCTTTTCAGCTTGTTGAATGCTTGCGAGAAATGCGCCAGCAGTGAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Nonsense 897 1107 27 35
Genomic Location (Zv9):
Chromosome 25 (position 8113721)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7726245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCTCTTTGTTTGTTTGTTTCCCAGGTACAACTGCAGATCGTTTCTAC[C/T]GAATAGATCGTGGTCAGGTACTTTGACRYTTTACATCTCTATTACGCGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link