ENSDARG00000076023

Ensembl ID:
ENSDARG00000076023
Human Orthologues:
SAMD9, SAMD9L
Human Descriptions:
sterile alpha motif domain containing 9 [Source:HGNC Symbol;Acc:1348]
sterile alpha motif domain containing 9-like [Source:HGNC Symbol;Acc:1349]
Mouse Orthologue:
Samd9l
Mouse Description:
sterile alpha motif domain containing 9-like Gene [Source:MGI Symbol;Acc:MGI:1343184]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12784 Nonsense Available for shipment Available now
sa2116 Nonsense F2 line generated During 2014
sa18746 Nonsense Mutation detected in F1 DNA During 2014
sa19940 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108899 Nonsense 543 1424 1 1
Genomic Location:
Chromosome 3 (position 6859291)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTAATGAGGACAAACARCATCAYGAARAGATCTTTTATAAGGGAGGG[A/T]AAGTGTCTTGGTGGAACTTCTACTTCTCAGAACAGCCCGGCTCRATGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2116
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108899 Nonsense 847 1424 1 1
Genomic Location:
Chromosome 3 (position 6860203)
KASP Assay ID:
554-3161.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTGAGGGTGTGCGAGTGATTCACTCATGTATAGCTAAACAATGCTTG[C/T]AGGAGCTTTCAGCTTCTCATGGAGTGACGAAGGCAGAAATCACTAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108899 Nonsense 850 1424 1 1
Genomic Location:
Chromosome 3 (position 6860213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCGAGTGATTCACTCATGTATAGCTAAACAATGCTTGCAGGAGCTTT[C/A]AGCTTCTCATGGAGTGACGAAGGCAGAAATCACTAACATTCTGCTTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108899 Nonsense 871 1424 1 1
Genomic Location:
Chromosome 3 (position 6860277)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACGAAGGCAGAAATCACTAACATTCTGCTTACAACAGAGTTATTTTA[C/A]GAGTACACTCTGGGAAAACAAAAATTAAGGCAGGATGTTCACAACATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xiz7cauv