TRIM65 (77 of 82)

Ensembl ID:
ENSDARG00000076019
Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42294 Nonsense Mutation detected in F1 DNA During 2016
sa38971 Nonsense Mutation detected in F1 DNA During 2016
sa2717 Essential Splice Site F2 line generated During 2016
sa13209 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056982 Nonsense 110 380 1 6
Genomic Location (Zv9):
Chromosome 13 (position 46758599)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46054367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTAAAGGAAGAAAACTCAAAGCCGTCAGGTCTTGTCTGGTGTGTT[T/A]GGCGTCATTCTGTCAAACTCACCTTCAGCCTCATTGTGACTCTGAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056982 Nonsense 167 380 1 6
Genomic Location (Zv9):
Chromosome 13 (position 46758428)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46054196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGAGATTTACTGCTACGAGGACAAGAGGTGTATTTGTGTGCTTTGTT[T/A]GGGTCAACACAGAGGACATAAGACTGTATCAGCCGCAAATGAAATGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2717
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056982 Essential Splice Site 219 380 3 6
Genomic Location (Zv9):
Chromosome 13 (position 46754742)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46050510
KASP Assay ID:
554-3377.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCAATTTGTAATTTATTAGGCTAATAACCTATGTTRCTGTGTCCTGAC[A/T]GAGCTCTGCACAGGCAGCAGTGGAGCACAGCGACAGGATCTTCACTGARC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056982 Nonsense 243 380 3 6
Genomic Location (Zv9):
Chromosome 13 (position 46754668)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46050436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACAGCGACAGGATCTTCACTGARCTCATTAGATCCCTTACCAAAAAA[C/T]GAACTGAAGTGAGAGGAGAGATCAGAGCTCAGGAGAAAAGGGAGACTCAR
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link