B3DHT6_DANRE

Ensembl ID:
ENSDARG00000076017
Description:
Transmembrane protein 69 [Source:UniProtKB/TrEMBL;Acc:B3DHT6]
Human Orthologue:
TMEM69
Human Description:
transmembrane protein 69 [Source:HGNC Symbol;Acc:28035]
Mouse Orthologue:
Tmem69
Mouse Description:
transmembrane protein 69 Gene [Source:MGI Symbol;Acc:MGI:3045357]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20734 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129916 Nonsense 66 249 2 2
Genomic Location (Zv9):
Chromosome 6 (position 33573550)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33891215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCAAGGCATGGTACCAGTGCTGTTCTGGGATCCCAGTCATTCCACTG[G/A]TCGGTCCACAGACTCAAGAAACAACCTCAAGGAGAAGAGAGTCCACCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link