LOC100332741

Ensembl ID:
ENSDARG00000076014
Human Orthologue:
ERC1
Human Description:
ELKS/RAB6-interacting/CAST family member 1 [Source:HGNC Symbol;Acc:17072]
Mouse Orthologue:
Erc1
Mouse Description:
ELKS/RAB6-interacting/CAST family member 1 Gene [Source:MGI Symbol;Acc:MGI:2151013]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26217 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086716 Nonsense 357 424 2 3
Genomic Location (Zv9):
Chromosome 4 (position 7439307)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 8251399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGGCCGATGCTGAAATGCACATCCACCATCTGGAGAGTTTGCTGGAT[C/T]AGAGGGACAAAGAGATGGGGCTGCTGAGAGAGGTAAGAGGAAACCAGCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link