LOC562087

Ensembl ID:
ENSDARG00000076011
Human Orthologue:
PPM1K
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1K [Source:HGNC Symbol;Acc:25415]
Mouse Orthologue:
Ppm1k
Mouse Description:
protein phosphatase 1K (PP2C domain containing) Gene [Source:MGI Symbol;Acc:MGI:2442111]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4256 Nonsense Mutation detected in F1 DNA During 2014
sa24411 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18150 Nonsense Available for shipment Available now
sa1186 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa4256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113757 Nonsense 31 358 1 6
Genomic Location:
Chromosome 23 (position 43982518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCGATGCGTGCATCCTGCCAGGWGTGTGCGTGTGCCYGGAGTCCGCTG[G/A]CACACCACTCGTTTGGACATGGACGGCAGCGGCCGTCCAGCCACCTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113757 Essential Splice Site 222 358 3 6
Genomic Location:
Chromosome 23 (position 43984816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAACTCACAGACGATCACACTCCGGAGAGAAAAGACGAGAAACACAGG[T/C]ACACACACACTTACACATACACAGATACTTGCATAGTTGTACTGACACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113757 Nonsense 256 358 4 6
Genomic Location:
Chromosome 23 (position 43991655)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTTAACGGCCGCTTGGCAATGACCCGCAGCATCGGAGACTTTGACTTG[A/T]AAAAAAGTGGCGTGATCGCTGAACCAGAGATCACACRGACTCTAGTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1186
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113757 Nonsense 319 358 6 6
Genomic Location:
Chromosome 23 (position 43996779)
KASP Assay ID:
554-1095.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGATAATTCTGATAGCACAAGTGTTTGTGTCGTCCAGGCTCTTCAGTA[C/A]GGCTCTGAGGACAACAGCACAGTGATCGTGGTCCCGTTTGGAGCCTGGGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a5slkpbf