LOC100329239

Ensembl ID:
ENSDARG00000076005
Human Orthologues:
AP005117.2, FAM38B
Human Descriptions:
family with sequence similarity 38, member B [Source:HGNC Symbol;Acc:26270]
Transmembrane protein C18orf30 [Source:UniProtKB/Swiss-Prot;Acc:Q8N787]
Mouse Orthologue:
Fam38b
Mouse Description:
family with sequence similarity 38, member B Gene [Source:MGI Symbol;Acc:MGI:1918781]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3288 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113688 Essential Splice Site 87 865 1 16
Genomic Location:
Chromosome 24 (position 939159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGCGGCCCAGCAAACGCTTCTGGATGACCGCCATCGTGTACACCGAGG[T/C]GCGTTTACTCTGTTCAGATTGGCTCCCCTTAGTTCTGTTGATGCTGTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f304th48