si:ch211-269e2.2

Ensembl ID:
ENSDARG00000076004
ZFIN ID:
ZDB-GENE-070912-268
Description:
Novel protein similar to vertebrate protein phosphatase 2 (Formerly 2A), regulatory subunit B family
Human Orthologue:
PPP2R3B
Human Description:
protein phosphatase 2, regulatory subunit B'', beta [Source:HGNC Symbol;Acc:13417]
Mouse Orthologue:
CAAA01108492.1.1364.1

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14604 Nonsense Available for shipment Available now
sa21534 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113656 Nonsense 324 583 7 13
ENSDART00000114043 Nonsense 250 463 7 12

The following transcripts of ENSDARG00000076004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35463054)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34682565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTTGAAGAGGATGAAGAGATTAACCAGTTGAMAGAGTTCTTCTCCTA[T/A]GAACAKTTCTATGTCATCTACTGTAAATTCTGGGAGCTGGATACAGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113656 Nonsense 569 583 13 13
ENSDART00000114043   None 463 None 12

The following transcripts of ENSDARG00000076004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35456397)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34675908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTGCACAGTGAGAAGAGACATCTGTTCGGGATCCCCAGCCCTCACTG[C/A]AACCTGGATCTGGATGAATATGAATACGAGGACGATTTCGAATGAGGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link