osbpl5

Ensembl ID:
ENSDARG00000076002
Human Orthologue:
OSBPL5
Human Description:
oxysterol binding protein-like 5 [Source:HGNC Symbol;Acc:16392]
Mouse Orthologue:
Osbpl5
Mouse Description:
oxysterol binding protein-like 5 Gene [Source:MGI Symbol;Acc:MGI:1930265]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44310 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30264 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109843 Essential Splice Site 645 865 16 21
Genomic Location (Zv9):
Chromosome 25 (position 24159293)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23338406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACGAGTGGTGCCGATTGACCAGCAGGAGGCGTTCGAGTCCGAGAGG[T/G]GCGGAAACACTTAGTCATTATAAAAATAGAGCAAAGCAAATAACAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109843 Essential Splice Site 748 865 18 21
Genomic Location (Zv9):
Chromosome 25 (position 24163693)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23342806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGACGCAACCGTTACTCCTACAGCCAGGACTGGGCTGGACAGCAGAAG[G/A]TGAGTCATATAGAAACTCCCACAAAGAAAATAAAAAATTCTAACCACCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link