si:ch211-197g15.13

Ensembl ID:
ENSDARG00000076001
ZFIN ID:
ZDB-GENE-091204-194
Description:
LOC798876 protein [Source:UniProtKB/TrEMBL;Acc:A8KB45]
Human Orthologue:
PIP5K1C
Human Description:
phosphatidylinositol-4-phosphate 5-kinase, type I, gamma [Source:HGNC Symbol;Acc:8996]
Mouse Orthologue:
Pip5k1c
Mouse Description:
phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma Gene [Source:MGI Symbol;Acc:MGI:1298224]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24142 Nonsense Available for shipment Available now
sa3152 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa24142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060786 Nonsense 636 682 16 18
ENSDART00000105443 Nonsense 587 633 16 17
ENSDART00000111931   None 274 None 7
Genomic Location (Zv9):
Chromosome 22 (position 17774726)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17525661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCGTGGTGGAGTCTGACGGCGGCAGTCAGGCCTCAGGCTGTACAAGT[A/T]GAGCCTCGGTGGACGAGGAGGATGACGTGCCAATCACAGACATTTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3152
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060786 Nonsense 675 682 17 18
ENSDART00000105443 Nonsense 626 633 17 17
ENSDART00000111931   None 274 None 7
Genomic Location (Zv9):
Chromosome 22 (position 17768162)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17519097
KASP Assay ID:
554-2472.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGGTTTATTCTCCTCTGCATTTCAGCTCAGGGCCTAAAACCCTGCCC[G/T]AGGATGAAGGGGAAAGTGAAACAGTAAGTGTGCATTGTGTCATTSATCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link