NP_001107105.1

Ensembl ID:
ENSDARG00000075996
Description:
zinc finger-like gene 1 [Source:RefSeq peptide;Acc:NP_001107105]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41383 Nonsense Mutation detected in F1 DNA During 2017
sa38729 Nonsense Mutation detected in F1 DNA During 2017
sa41382 Nonsense Mutation detected in F1 DNA During 2017
sa12883 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109238 Nonsense 8 505 1 1
ENSDART00000141063 Nonsense 8 505 2 2
Genomic Location (Zv9):
Chromosome 9 (position 16748382)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15901787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGAGGGCACTGTCCTGTACTTCCCATGGCTGAGTCTGCAAGGAACTA[T/A]GCTAATGGAGCTACCCTGAGAACAACATCAGAAAAGAATGGAACAGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109238 Nonsense 70 505 1 1
ENSDART00000141063 Nonsense 70 505 2 2
Genomic Location (Zv9):
Chromosome 9 (position 16748197)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15901972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGTGCAAGAAGTACAGCATCAAGCACTCAGAGAGTGGATTATGGGCAT[T/A]GCCGGACATTAAAAGGGCTTATGGAAAGACACAGCGCTTATGCACAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109238 Nonsense 124 505 1 1
ENSDART00000141063 Nonsense 124 505 2 2
Genomic Location (Zv9):
Chromosome 9 (position 16748036)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15902133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAGATTGACAGATTGGAACGTGAGAACAAAGCGGAGAAAGCTAAAGTT[C/T]GAGCACTGGCTGAACAATTGCAAAACTTAAAGAAGGATAAAGAAAGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109238 Nonsense 474 505 1 1
ENSDART00000141063 Nonsense 474 505 2 2
Genomic Location (Zv9):
Chromosome 9 (position 16746986)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15903183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAATGAAGAAGGACACTGGGCCCGTGAGTGCAAGCTCAGTTTAAAACAT[C/T]AAAGTAAGGATGATGACCACCTGTTCAAGCAGTTTCAGCAGCTAACAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link