ENSDARG00000075992

Ensembl ID:
ENSDARG00000075992
Human Orthologue:
GIN1
Human Description:
gypsy retrotransposon integrase 1 [Source:HGNC Symbol;Acc:25959]
Mouse Orthologue:
Gin1
Mouse Description:
gypsy retrotransposon integrase 1 Gene [Source:MGI Symbol;Acc:MGI:2182036]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8491 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2125 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa8491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109820 Essential Splice Site 51 299 None 6
ENSDART00000126813 None 3 280 1 8
Genomic Location:
Chromosome 3 (position 43433267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTGCTTAATACTGTTTTTATAAGATCTTAATACTTTAATTTRTTTTC[A/C]GAGGATGAATTGTTTTACATAAAAAACAATGCCCACAAAGAACAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2125
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109820 Nonsense 264 299 6 6
ENSDART00000126813 None None 280 None 8
Genomic Location:
Chromosome 3 (position 43431581)
KASP Assay ID:
554-3355.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTATTTTATCACATGTTTTTTAGGGTCCTATCTAAACTGGTAAAGGAC[A/T]AACCAAATACTTGGGACCAGTATTTGGATGCTGCCATGTTCGGACTTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hio18hmk