ENSDARG00000075992

Ensembl ID:
ENSDARG00000075992
Human Orthologue:
GIN1
Human Description:
gypsy retrotransposon integrase 1 [Source:HGNC Symbol;Acc:25959]
Mouse Orthologue:
Gin1
Mouse Description:
gypsy retrotransposon integrase 1 Gene [Source:MGI Symbol;Acc:MGI:2182036]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31352 Nonsense Mutation detected in F1 DNA During 2016
sa33289 Nonsense Mutation detected in F1 DNA During 2016
sa8491 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2125 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa31352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109820 Nonsense 16 299 1 6
ENSDART00000126813   None 280 None 8
Genomic Location (Zv9):
Chromosome 3 (position 43436273)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42473207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGTCAAATCTTGCTGCACTACCAACGGGTCATGGAGGGTGACAAATA[T/G]AACTCATTGAAACAGTTTCTTCTTTTTGGAGAATATCCAAAAAATGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109820 Nonsense 40 299 1 6
ENSDART00000126813   None 280 None 8
Genomic Location (Zv9):
Chromosome 3 (position 43436202)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42473278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTTGGAGAATATCCAAAAAATGCAAACAAACAGCAGCGTTTTGTAT[T/A]GAAACGACGAGCTGGGAAGTTCTGTATGATAGGTAAGTCAAATAAAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109820 Essential Splice Site 51 299 None 6
ENSDART00000126813   3 280 1 8
Genomic Location (Zv9):
Chromosome 3 (position 43433267)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42476213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTGCTTAATACTGTTTTTATAAGATCTTAATACTTTAATTTRTTTTC[A/C]GAGGATGAATTGTTTTACATAAAAAACAATGCCCACAAAGAACAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2125
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109820 Nonsense 264 299 6 6
ENSDART00000126813   None 280 None 8
Genomic Location (Zv9):
Chromosome 3 (position 43431581)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 42477899
KASP Assay ID:
554-3355.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTATTTTATCACATGTTTTTTAGGGTCCTATCTAAACTGGTAAAGGAC[A/T]AACCAAATACTTGGGACCAGTATTTGGATGCTGCCATGTTCGGACTTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link