acap3a

Ensembl ID:
ENSDARG00000075990
ZFIN ID:
ZDB-GENE-030131-1711
Human Orthologue:
ACAP3
Human Description:
ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 [Source:HGNC Symbol;Acc:16754]
Mouse Orthologue:
Acap3
Mouse Description:
ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 Gene [Source:MGI Symbol;Acc:MGI:2153589]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37770 Nonsense Mutation detected in F1 DNA During 2016
sa18197 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109976 Nonsense 219 575 7 16
ENSDART00000139563   None 345 None 9
Genomic Location (Zv9):
Chromosome 23 (position 37010469)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36791731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAATTGGGGAACAGTATTATCAACCACATCTATGAAGGCAGCTGTGAA[G/T]AGCAGGGCCTGAAGAAACCAGCACCCAACAGCTCCAGGTGACTGATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109976 Nonsense 490 575 13 16
ENSDART00000139563 Nonsense 260 345 6 9
Genomic Location (Zv9):
Chromosome 23 (position 37001723)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36783533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAATTARCAATTTGTTTTATTTCCAGGCAAGTGTGCTTGTTTCTGAAA[C/T]GAGGAGCAACTCAAAAYGACGGGGATGAGGATGGACARGACCCGCTGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link