arpc2

Ensembl ID:
ENSDARG00000075989
ZFIN ID:
ZDB-GENE-030131-5276
Description:
actin-related protein 2/3 complex subunit 2 [Source:RefSeq peptide;Acc:NP_997864]
Human Orthologue:
ARPC2
Human Description:
actin related protein 2/3 complex, subunit 2, 34kDa [Source:HGNC Symbol;Acc:705]
Mouse Orthologue:
Arpc2
Mouse Description:
actin related protein 2/3 complex, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1923959]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa160 Missense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa160
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099803 Missense 151 299 5 10
Genomic Location:
Chromosome 9 (position 49048083)
KASP Assay ID:
554-0020.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTCGCGATGGCGAGAAAAGAGCCGTTGTTCATTACAGGGACGACGAGT[C/T]GATGTAAGATACTGAGAGTTCCTTCAAACTGTTTTCATAATCAGCTAGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kpf77mv6