olfch1

Ensembl ID:
ENSDARG00000075988
ZFIN ID:
ZDB-GENE-060503-819
Description:
hypothetical protein LOC100004933 [Source:RefSeq peptide;Acc:NP_001103760]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13136 Nonsense Available for shipment Available now
sa42369 Nonsense Mutation detected in F1 DNA During 2016
sa42370 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104792 Nonsense 206 853 3 6
Genomic Location (Zv9):
Chromosome 14 (position 17908693)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33020958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTACTACCAGAGCAGAGCACTGGCACAGTTAGTGAAACACTTCGGGT[G/A]GACCTGGATTGGAGCAGTAAGAAGTGWCAATGACTATGGAAACAATGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104792 Nonsense 497 853 4 6
Genomic Location (Zv9):
Chromosome 14 (position 17909653)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33021918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAAAGTTCATCACTGTAGGACAATATGATGCCTCGCTATCCAGTGAA[C/T]AGCAGTTTGTCATTAATTCGTTCGATATAATTTGGGCAGGAGACAGTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104792 Nonsense 567 853 6 6
Genomic Location (Zv9):
Chromosome 14 (position 17910149)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33022414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTGTATTTTTAGATTCAGCTGAATGCATCAAATGTCCATTAGAATA[C/A]TGGTCAAATAAAAACCACAGCATCTGTGTTCTCAAAAAGGTGGAATTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link