LOC568632

Ensembl ID:
ENSDARG00000075986
Human Orthologue:
RIC3
Human Description:
resistance to inhibitors of cholinesterase 3 homolog (C. elegans) [Source:HGNC Symbol;Acc:30338]
Mouse Orthologue:
Ric3
Mouse Description:
resistance to inhibitors of cholinesterase 3 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:24

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5419 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115132 Nonsense 83 517 2 6
Genomic Location:
Chromosome 7 (position 29182342)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTTTTTTTTTTTTCTTGNAAGTTGGACCAGGGCATTTACCTCCATCA[C/T]GACACATCCATTCACTGTCTGAAGATCATGATCACTGGGATACAGACTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vm24giet