pcdh1g30

Ensembl ID:
ENSDARG00000075978
ZFIN IDs:
ZDB-GENE-041118-16, ZDB-GENE-041118-17, ZDB-GENE-041118-17, ZDB-GENE-041118-17, ZDB-GENE-041118-17, ZDB-GENE-050609-22, ZDB-GENE-050609-23, ZDB-GENE-050609-23, ZDB-GENE-050609-24, ZDB-GENE-050609-24, ZDB-GENE-050609-25
Description:
protocadherin 1 gamma c 5 [Source:RefSeq peptide;Acc:NP_001012674]
Human Orthologues:
PCDHGC4, PCDHGC5
Human Descriptions:
protocadherin gamma subfamily C, 4 [Source:HGNC Symbol;Acc:8717]
protocadherin gamma subfamily C, 5 [Source:HGNC Symbol;Acc:8718]
Mouse Orthologue:
Pcdhga11
Mouse Description:
protocadherin gamma subfamily A, 11 Gene [Source:MGI Symbol;Acc:MGI:1935228]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21721 Nonsense Available for shipment Available now
sa31779 Nonsense Available for shipment Available now
sa34893 Nonsense Mutation detected in F1 DNA During 2017
sa31780 Splice Site, Nonsense Available for shipment Available now
sa34894 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109850 Nonsense 69 951 1 4
ENSDART00000111183   None 957 None 4
ENSDART00000121954   None 814 None 4
ENSDART00000125115   None 832 None 4
ENSDART00000125243   None 949 None 4
ENSDART00000127347   None 951 None 4
ENSDART00000128580   None 830 None 2
ENSDART00000129556   None 818 None 2
ENSDART00000130235   None 851 None 6
ENSDART00000130399   None 874 None 9
Genomic Location (Zv9):
Chromosome 10 (position 21869991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGTTTGAAAATATCTGAGCTGTATGACCGTAAACTGCGAATAGCTTCT[G/T]AATCGGGTAAACAGTATTTCAGTCTGGATTTAAGCAGAGGAGAGATTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109850 Nonsense 430 951 1 4
ENSDART00000111183   None 957 None 4
ENSDART00000121954   None 814 None 4
ENSDART00000125115   None 832 None 4
ENSDART00000125243   None 949 None 4
ENSDART00000127347   None 951 None 4
ENSDART00000128580   None 830 None 2
ENSDART00000129556   None 818 None 2
ENSDART00000130235   None 851 None 6
ENSDART00000130399   None 874 None 9
Genomic Location (Zv9):
Chromosome 10 (position 21871075)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21848719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCGTGAAAGGTATCCAGAGTATAACGTGGAAATCACTGCTTTTGACT[C/A]AGGCACACCATCTTTGAGTAGCAAAACAATAATTCCTGTTAAAATTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109850   None 951 None 4
ENSDART00000111183   None 957 None 4
ENSDART00000121954   None 814 None 4
ENSDART00000125115   None 832 None 4
ENSDART00000125243 Nonsense 273 949 1 4
ENSDART00000127347   None 951 None 4
ENSDART00000128580   None 830 None 2
ENSDART00000129556   None 818 None 2
ENSDART00000130235   None 851 None 6
ENSDART00000130399   None 874 None 9
Genomic Location (Zv9):
Chromosome 10 (position 22002885)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21833413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCGTTTTAACTGTAAAAGCCACAGATTTAGATGAAGGTCTAAATGGC[G/T]AAATACAATATTTCTTCGGTGCACATACACCAGATGCTGTGAAGAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109850   None 951 None 4
ENSDART00000111183   None 957 None 4
ENSDART00000121954   None 814 None 4
ENSDART00000125115   None 832 None 4
ENSDART00000125243 Splice Site, Nonsense 813 949 1 4
ENSDART00000127347   None 951 None 4
ENSDART00000128580   None 830 None 2
ENSDART00000129556   None 818 None 2
ENSDART00000130235   None 851 None 6
ENSDART00000130399   None 874 None 9
Genomic Location (Zv9):
Chromosome 10 (position 22004505)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21835033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACGCTTGATGCGTCATTACCAGACAGCGCGTGGACATTCGAGAGCCAA[C/T]AGGTGAGACAAACTTAATTGTAAACAAATTCTTGGTCATAAATGCAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109850 Nonsense 915 951 4 4
ENSDART00000111183 Nonsense 921 957 4 4
ENSDART00000121954   None 814 4 4
ENSDART00000125115   None 832 4 4
ENSDART00000125243 Nonsense 913 949 4 4
ENSDART00000127347 Nonsense 915 951 4 4
ENSDART00000128580   None 830 None 2
ENSDART00000129556   None 818 None 2
ENSDART00000130235   None 851 None 6
ENSDART00000130399   None 874 9 9
Genomic Location (Zv9):
Chromosome 10 (position 22030561)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21861089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTCTACATCCCAGGCAGCACTGCCACCCTTACAGCCAACCCTCAGCAA[C/T]AGGTTCTCCAGCAGGCCCTTCCTCCACCACAGGCCCTTCCACCTACCGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link