LOC555584

Ensembl ID:
ENSDARG00000075977
Human Orthologue:
PRR5
Human Description:
proline rich 5 (renal) [Source:HGNC Symbol;Acc:31682]
Mouse Orthologue:
Prr5
Mouse Description:
proline rich 5 (renal) Gene [Source:MGI Symbol;Acc:MGI:1924714]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4318 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15729 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099355 Essential Splice Site 185 453 6 9
Genomic Location:
Chromosome 25 (position 21750636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTGTGATGTTCTCACCATGCTTCAAGCCATCTTTCACCCCGTCCAGG[T/C]ACAGTCCAGTCATACAGYGAAATAAGCTGATAGGCAGCAGGTACAGTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099355 Nonsense 265 453 8 9
Genomic Location:
Chromosome 25 (position 21747614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCCTTCAGAAGGTGGTGTCCCCGTATCTGGGCACACAAGGACTGTG[T/A]TCACACGAGTGTGGAGCTTCTCACTGCTCCTGCTTTATTGGTGAGAGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mnu1n1z4