LOC555584

Ensembl ID:
ENSDARG00000075977
Human Orthologue:
PRR5
Human Description:
proline rich 5 (renal) [Source:HGNC Symbol;Acc:31682]
Mouse Orthologue:
Prr5
Mouse Description:
proline rich 5 (renal) Gene [Source:MGI Symbol;Acc:MGI:1924714]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38066 Nonsense Mutation detected in F1 DNA During 2016
sa4318 Essential Splice Site Mutation detected in F1 DNA During 2016
sa44296 Nonsense Mutation detected in F1 DNA During 2016
sa15729 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099355 Nonsense 133 453 4 9
Genomic Location:
Chromosome 25 (position 21750995)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTCAGGCAGCTATTAAAGACTGAGCTGGGCTCATTCTTTACAGAGTA[T/A]CTTCAGGTGAGATTTGTTCTGATGTGTCATATGTTTGTTAATTGTAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099355 Essential Splice Site 185 453 6 9
Genomic Location:
Chromosome 25 (position 21750636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTGTGATGTTCTCACCATGCTTCAAGCCATCTTTCACCCCGTCCAGG[T/C]ACAGTCCAGTCATACAGYGAAATAAGCTGATAGGCAGCAGGTACAGTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099355 Nonsense 217 453 7 9
Genomic Location:
Chromosome 25 (position 21747962)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACACCATCACCCTTAACATGAAGCTGGACGAGGCTCTGTCTAGACCA[C/T]GAGCCCGGGTCCCGCCCTCCATCGTCCAGATGCTTCTGGTATTACAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099355 Nonsense 265 453 8 9
Genomic Location:
Chromosome 25 (position 21747614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCCTTCAGAAGGTGGTGTCCCCGTATCTGGGCACACAAGGACTGTG[T/A]TCACACGAGTGTGGAGCTTCTCACTGCTCCTGCTTTATTGGTGAGAGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link