ENSDARG00000075969

Ensembl ID:
ENSDARG00000075969
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19942 Nonsense Mutation detected in F1 DNA During 2014
sa2111 Nonsense F2 line generated During 2014
sa5726 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa19942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099000 Nonsense 228 1373 1 1
Genomic Location:
Chromosome 3 (position 7135627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATATCAAAGAATCATTTCTGCCTCATCAGGGGAAACTGTGGCGTCAGT[G/A]GAGCCAAAAGAACAAAGAACTACATCGATATCGAGGAGATGAGACAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2111
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099000 Nonsense 335 1373 1 1
ENSDART00000099000 Nonsense 335 1373 1 1
Genomic Location:
Chromosome 3 (position 7135947)
KASP Assay ID:
554-3048.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGAAACTGAAAGAGCGATATGATAAATCTGAGCAAATAAAAGCTGAA[C/T]AAACTGAACTTGAGAGAATATCCGAGGATCTTCAAGCTGCCATGTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5726
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099000 Nonsense 335 1373 1 1
ENSDART00000099000 Nonsense 335 1373 1 1
Genomic Location:
Chromosome 3 (position 7135947)
KASP Assay ID:
554-3048.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGAAACTGAAAGAGCGATATGATAAATCTGAGCAAATAAAAGCTGAA[C/T]AAACTGAACTTGAGAGAATATCCGAGGATCTTCAAGCTGCCATGTTTAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t2nzzeb7