ENSDARG00000075965

Ensembl ID:
ENSDARG00000075965
Human Orthologues:
GTF2IRD2, GTF2IRD2B
Human Descriptions:
GTF2I repeat domain containing 2 [Source:HGNC Symbol;Acc:30775]
GTF2I repeat domain containing 2B [Source:HGNC Symbol;Acc:33125]
Mouse Orthologue:
Gtf2ird2
Mouse Description:
GTF2I repeat domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2149780]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10014 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114013 Nonsense 85 495 1 5
Genomic Location:
Chromosome 7 (position 71128870)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAACAGCGATTCTTCACACGGGCCTGTGAGTCAAACGAGAGCATCACC[A/T]AAGCTAGCTACGAAGTGGCCWTGTTAATTGCTAAACATGGCAAACCTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/74mf559u