ENSDARG00000075964

Ensembl ID:
ENSDARG00000075964
Human Orthologues:
ARHGEF40, PLEKHG4
Human Descriptions:
pleckstrin homology domain containing, family G (with RhoGef domain) member 4 [Source:HGNC Symbol;Ac
Rho guanine nucleotide exchange factor (GEF) 40 [Source:HGNC Symbol;Acc:25516]
Mouse Orthologues:
E130112L23Rik, Plekhg4
Mouse Descriptions:
pleckstrin homology domain containing, family G (with RhoGef domain) member 4 Gene [Source:MGI Symbo
RIKEN cDNA E130112L23 gene Gene [Source:MGI Symbol;Acc:MGI:2685515]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7074 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21000 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108473 Essential Splice Site 1372 2484 4 22
Genomic Location:
Chromosome 7 (position 36185731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTGTTCACCTGTTCCCGCCCTTTTCAAAGCCTTYAACATCCTCCAGG[T/C]AAGAACACCCTGAMAGTATGATTTGYAATAACAAACACGCATGCAGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108473 Nonsense 1430 2484 6 22
Genomic Location:
Chromosome 7 (position 36191711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTGGACGTTTCTCAGCTTCCCACTGAGTTTGAAGGCACTTTCCCTTA[T/G]GCACACAGCAGCTGGGTCAGCTTTAGAATGGTGAGAAAATCACAATCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/idtccx0y