si:ch211-255p13.2

Ensembl ID:
ENSDARG00000075962
ZFIN IDs:
ZDB-GENE-030131-7134, ZDB-GENE-070912-251
Description:
guanine nucleotide exchange factor VAV3 [Source:RefSeq peptide;Acc:NP_001119865]
Human Orthologue:
VAV3
Human Description:
vav 3 guanine nucleotide exchange factor [Source:HGNC Symbol;Acc:12659]
Mouse Orthologue:
Vav3
Mouse Description:
vav 3 oncogene Gene [Source:MGI Symbol;Acc:MGI:1888518]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32867 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30592 Nonsense Mutation detected in F1 DNA During 2017
sa18562 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110059 Essential Splice Site 414 822 13 27
ENSDART00000142828   None 241 None 10

The following transcripts of ENSDARG00000075962 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 15904801)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16415628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGTGAAGTGCGTTTGGTGTCAAATTTGGACAAGCGCAGACAGGACAGG[T/C]GAGGCTTCAGGCAATAACCTTTACTGCAGGCTTCTCTTGTTTTTTCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30592
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110059 Nonsense 541 822 17 27
ENSDART00000142828 Nonsense 48 241 2 10

The following transcripts of ENSDARG00000075962 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 15875491)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16386318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGTACTCAGGGGGATTTTTAACCAAGGCTACCTTTGTCCTAAATGT[G/T]GAAACGGGGCTCATAAGGGCTGTCTGGGTAAACTGGGAGTCTGTGGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110059 Nonsense 812 822 27 27
ENSDART00000142828   None 241 None 10

The following transcripts of ENSDARG00000075962 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 15814624)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16325451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTATAGTGTTTTATATTACAGATRTGTTTTATATTACAGGTTGGCTG[G/A]TTTCCTTCAACATATGTGGAAGAGGAGGAGTGAACGGCGCAGGAATTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link