LOC797483

Ensembl ID:
ENSDARG00000075956
Human Orthologue:
C6orf168
Human Description:
chromosome 6 open reading frame 168 [Source:HGNC Symbol;Acc:20742]
Mouse Orthologue:
6230409E13Rik
Mouse Description:
RIKEN cDNA 6230409E13 gene Gene [Source:MGI Symbol;Acc:MGI:1923382]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18658 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113864 Nonsense 401 404 6 6
Genomic Location:
Chromosome 4 (position 5624859)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTCTGTGTGACTCTGATATGGACACCGAATGCTCAGTCTCAGAGGCG[G/T]AGCTACTGAAGTGATGGCCACACCTCATTTGAWGATGTGTCTGCACGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7a1r4o59