LOC797483

Ensembl ID:
ENSDARG00000075956
Human Orthologue:
C6orf168
Human Description:
chromosome 6 open reading frame 168 [Source:HGNC Symbol;Acc:20742]
Mouse Orthologue:
6230409E13Rik
Mouse Description:
RIKEN cDNA 6230409E13 gene Gene [Source:MGI Symbol;Acc:MGI:1923382]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26213 Nonsense Mutation detected in F1 DNA During 2016
sa33375 Nonsense Mutation detected in F1 DNA During 2016
sa18658 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26213
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113864 Nonsense 36 404 1 6
Genomic Location:
Chromosome 4 (position 5637189)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGGAGCTTCTCCTTCGGCCTCTGCAGGTCCGACGAGCAAATGTCTT[T/A]GCATGGGTTCATCATCGCCTACCCGCTGCAGGAGTACGGGGGGATCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113864 Nonsense 309 404 5 6
Genomic Location:
Chromosome 4 (position 5626961)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCCAGGCCATGTGGACTCTTCCAGGAACACGTCCAGAGCAGTTAATT[A/T]AAGGTGAGCTCATTAACTTACAATAGTTTCATCATTTCTTCACATCCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113864 Nonsense 401 404 6 6
Genomic Location:
Chromosome 4 (position 5624859)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTCTGTGTGACTCTGATATGGACACCGAATGCTCAGTCTCAGAGGCG[G/T]AGCTACTGAAGTGATGGCCACACCTCATTTGAWGATGTGTCTGCACGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link