mbd2

Ensembl ID:
ENSDARG00000075952
ZFIN ID:
ZDB-GENE-030131-9049
Description:
methyl-CpG-binding domain protein 2 [Source:RefSeq peptide;Acc:NP_997933]
Human Orthologue:
MBD2
Human Description:
methyl-CpG binding domain protein 2 [Source:HGNC Symbol;Acc:6917]
Mouse Orthologue:
Mbd2
Mouse Description:
methyl-CpG binding domain protein 2 Gene [Source:MGI Symbol;Acc:MGI:1333813]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13553 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115044 Nonsense 2 137 1 3
Genomic Location:
Chromosome 5 (position 1437054)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACRGATATCAGCAGCTCCGATCGGGCTGATCGATCAGTTATTGATCATG[G/T]AGAAGAAGAGGACGGACTGCCCCGCGCTTCCTCCCGGCTGGAAGAAGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6mr6uthl