ENSDARG00000075951

Ensembl ID:
ENSDARG00000075951
Human Orthologues:
MUC17, MUC5B
Human Descriptions:
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6599 Nonsense Mutation detected in F1 DNA During 2016
sa39654 Nonsense Mutation detected in F1 DNA During 2016
sa32725 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114414 Nonsense 3172 4056 34 35
Genomic Location (Zv9):
Chromosome 1 (position 41083064)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39969843
KASP Assay ID:
554-4964.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAACATCAACAACTGTAGATGTGAACCTCACAACCACTCTTATACCMT[C/A]AGAAACTACAACAACAACACTATCTTCAACATCTGAAACTGCAGAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114414 Nonsense 3712 4056 34 35
Genomic Location (Zv9):
Chromosome 1 (position 41081444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCACAGAAAGTGCTGGTGCCACAATCCCATCTTCAACAACTGAAACTT[C/A]AACATCTACAGTTGTATCTTCCCACAGTCACTTTTATACCCACAGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114414 Nonsense 4043 4056 35 35
Genomic Location (Zv9):
Chromosome 1 (position 41080436)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39973097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCAGCCACATCTTTGCAAAATGAAACTACAAATGCAGTGACTTCAATT[C/T]AAATTACAGACACTCAAAAGCCAACAATGTCAATAACAAGCCCTGAACCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link