prkd1

Ensembl ID:
ENSDARG00000075949
Human Orthologue:
PRKD1
Human Description:
protein kinase D1 [Source:HGNC Symbol;Acc:9407]
Mouse Orthologue:
Prkd1
Mouse Description:
protein kinase D1 Gene [Source:MGI Symbol;Acc:MGI:99879]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6481 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23102 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110322 Essential Splice Site 268 878 5 18
Genomic Location (Zv9):
Chromosome 17 (position 28998596)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28922523
KASP Assay ID:
554-5194.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCAAGAAGCTCCTCAAGGGCCTGTTCCGTCAGGGACTGCAGTGCAAAG[G/A]TAGGATCCGCAATATCTCAAGCTTTAGTTAGAAAACAATCATCTTGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110322 Essential Splice Site 361 878 7 18
Genomic Location (Zv9):
Chromosome 17 (position 29004357)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28928284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGAGATTTTCAAGACCTAGACCCGGATGAGTCCAACAGGATCATCAG[G/A]TAGATCCTCTGCACTTCTAGAAGCCCTGTAAACATAACCAACATCACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link