LOC100334726

Ensembl ID:
ENSDARG00000075947
Human Orthologue:
PIK3CA
Human Description:
phosphoinositide-3-kinase, catalytic, alpha polypeptide [Source:HGNC Symbol;Acc:8975]
Mouse Orthologue:
Pik3ca
Mouse Description:
phosphatidylinositol 3-kinase, catalytic, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:1206581]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25449 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112973 Essential Splice Site 119 1071 1 19
Genomic Location:
Chromosome Zv9_scaffold3553 (position 134087)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGAACCTGTAGGGAACAGAGAGGAAAAGATCCTCAACAGAGAAATTGG[T/G]AAGACTTTAAACTTTGGCAGCTTTTTTTTTATCTACTACAGGGGTGGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ueukbciv