si:ch211-250c4.5

Ensembl ID:
ENSDARG00000075943
ZFIN ID:
ZDB-GENE-081107-33
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B7ZD99]
Human Orthologue:
CCDC110
Human Description:
coiled-coil domain containing 110 [Source:HGNC Symbol;Acc:28504]
Mouse Orthologue:
Ccdc110
Mouse Description:
coiled-coil domain containing 110 Gene [Source:MGI Symbol;Acc:MGI:2685018]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22220 Nonsense Available for shipment Available now
sa22219 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109666 Nonsense 373 605 1 2
ENSDART00000137002   None 237 None 2
Genomic Location (Zv9):
Chromosome 13 (position 7641477)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7945997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACGCCGAGCACAAGAAGAACATCAGCGTCATTCAGAGACTTGAGGAG[G/T]AGGTGTCAGCCTTGAGAAGAGAATCTGCAAACTTCAGAGATCATTTACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109666 Nonsense 537 605 1 2
ENSDART00000137002   None 237 None 2
Genomic Location (Zv9):
Chromosome 13 (position 7640984)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7945504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGACTCAAAGAGGCCATTGGTTTGCTGGAGCGAGAGAGAGAAGTGCTGT[T/A]AGCAGAGATGGAAGACTTGCGTAAGGATTACCTTGGGATCAGTGACAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link