si:ch211-69m14.1

Ensembl ID:
ENSDARG00000075942
ZFIN ID:
ZDB-GENE-050419-226
Description:
Novel FERM domain containing protein [Source:UniProtKB/TrEMBL;Acc:A8DZC9]
Human Orthologue:
FRMD5
Human Description:
FERM domain containing 5 [Source:HGNC Symbol;Acc:28214]
Mouse Orthologue:
Frmd5
Mouse Description:
FERM domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2442557]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23313 Nonsense Available for shipment Available now
sa10808 Nonsense Available for shipment Available now
sa19205 Nonsense Mutation detected in F1 DNA During 2017
sa13053 Essential Splice Site Available for shipment Available now
sa36659 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7447 Missense Mutation detected in F1 DNA During 2017
sa23312 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Nonsense 79 540 4 14
ENSDART00000135133 Nonsense 77 179 4 6
Genomic Location (Zv9):
Chromosome 18 (position 26437262)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26510517
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATGTTTACTCTGCTTTATGTTTTGCCTTTGTGTGCTGTTTTCAGGTA[T/A]CTCGTCTTCCTGCAGATTAAGAGAGATTTGTATCATGGTCGTCTCCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10808
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Nonsense 164 540 6 14
ENSDART00000135133 Nonsense 162 179 6 6
ENSDART00000113280 Nonsense 164 540 6 14
ENSDART00000135133 Nonsense 162 179 6 6
Genomic Location (Zv9):
Chromosome 18 (position 26426794)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26500049
KASP Assay ID:
2261-2262.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTAMTGTTTTGCAGAGGTCAAACCCCAGAGACTTCTGAGCTGAAGTTCT[T/A]GCAGAAAGCACAAATGCTTGAAACATACGGTGTGGATCCTCATCCGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Nonsense 164 540 6 14
ENSDART00000135133 Nonsense 162 179 6 6
ENSDART00000113280 Nonsense 164 540 6 14
ENSDART00000135133 Nonsense 162 179 6 6
Genomic Location (Zv9):
Chromosome 18 (position 26426794)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26500049
KASP Assay ID:
2261-2262.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAATGTTTTGCAGAGGTCAAACCCCAGAGACTTCTGAGCTGAAGTTCT[T/A]GCAGAAAGCACAAATGCTTGAAACATACGGTGTGGATCCTCATCCGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Essential Splice Site 233 540 9 14
ENSDART00000135133   None 179 None 6
Genomic Location (Zv9):
Chromosome 18 (position 26421903)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26495249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATGACARWSCTGTATCAGTGCACCTTTAATAATSGTTTRTTATGCAC[A/C]GGACAAAAAGATCATCTTGACATACTTTGCACCCACCCCAGAGGCCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Essential Splice Site 343 540 13 14
ENSDART00000135133   None 179 None 6
Genomic Location (Zv9):
Chromosome 18 (position 26416331)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26489677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTCCCTCGCACCCGCCGGAGAGCGGTACACATCTCCATCATGGAAG[G/A]TGAGAGTCCAGTTTTAAGCACGAGTTCAGCTGGAAGCATAGGCACAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Missense 501 540 14 14
ENSDART00000135133   None 179 None 6
Genomic Location (Zv9):
Chromosome 18 (position 26402733)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26476079
KASP Assay ID:
554-4329.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGCTCCTCCTCCTCATCGTYCTCACCGAGTCCGATCTTGACATTGCA[T/A]TTTTACGTGATATCCGCCAGACCCCCGAGTTTGAGCAGTTCCATTACGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Nonsense 525 540 14 14
ENSDART00000135133   None 179 None 6
Genomic Location (Zv9):
Chromosome 18 (position 26402659)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26476005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGAGTTTGAGCAGTTCCATTACGAATACTTTTGTCCCCTCAGACGGTG[G/A]TTTGCCTGCAAGCTCCGCTGGGTGGGCGGGCTGCTCATTAACAAGTGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link