ENSDARG00000075935

Ensembl ID:
ENSDARG00000075935
Human Orthologues:
PCDHB1, PCDHG@, PCDHGA1, PCDHGA10, PCDHGA11, PCDHGA12, PCDHGA3, PCDHGA5, PCDHGA6, PCDHGA7, PCDHGA8
Human Descriptions:
protocadherin beta 1 [Source:HGNC Symbol;Acc:8680]
protocadherin gamma cluster [Source:HGNC Symbol;Acc:8695]
protocadherin gamma subfamily A, 1 [Source:HGNC Symbol;Acc:8696]
protocadherin gamma subfamily A, 10 [Source:HGNC Symbol;Acc:8697]
protocadherin gamma subfamily A, 11 [Source:HGNC Symbol;Acc:8698]
protocadherin gamma subfamily A, 12 [Source:HGNC Symbol;Acc:8699]
protocadherin gamma subfamily A, 3 [Source:HGNC Symbol;Acc:8701]
protocadherin gamma subfamily A, 5 [Source:HGNC Symbol;Acc:8703]
protocadherin gamma subfamily A, 6 [Source:HGNC Symbol;Acc:8704]
protocadherin gamma subfamily A, 7 [Source:HGNC Symbol;Acc:8705]
protocadherin gamma subfamily A, 8 [Source:HGNC Symbol;Acc:8706]
Mouse Orthologue:
Pcdhb1
Mouse Description:
protocadherin beta 1 Gene [Source:MGI Symbol;Acc:MGI:2136730]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28242 Nonsense Mutation detected in F1 DNA During 2017
sa42336 Nonsense Mutation detected in F1 DNA During 2017
sa35624 Nonsense Mutation detected in F1 DNA During 2017
sa42337 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109575 Nonsense 6 811 1 1
Genomic Location (Zv9):
Chromosome 14 (position 3000372)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2033533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCATCTTAAGTGGAACAGAAGATCTGGATTATGTCGTTTCTTTGTTG[T/A]TTTTCCGCGCACAGAGGCGCGTCTTCGTCGCGGATTTCATCATGGCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109575 Nonsense 290 811 1 1
Genomic Location (Zv9):
Chromosome 14 (position 3001223)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2032682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTGCAGCAGACGGAGACACTGGATCTAATGGAGAAGTTACGTATTCTT[T/A]ATCTCAAAGCAGTGAAAGCTTTTCTGGCCTTTTTAACATTGACTCCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109575 Nonsense 324 811 1 1
Genomic Location (Zv9):
Chromosome 14 (position 3001326)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2032579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGATATTACAGTTAATGGTTATTTAGATTACGAGAAATCTAAAAAATA[T/A]GAACTATACGTTGAAGCAACAGACAAAGGAGGGTTACGGGACACAAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109575 Nonsense 362 811 1 1
Genomic Location (Zv9):
Chromosome 14 (position 3001439)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2032466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAACTGATATAAACGATAATCCTCCTATAATAAGCGTAATTTCATTTT[C/A]AAGCCCCGTGCCGGAGAATTCAGCTCCAGAGACTGCAGTAGCAATGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link