cox15

Ensembl ID:
ENSDARG00000075933
ZFIN IDs:
ZDB-GENE-040426-955, ZDB-GENE-040426-955
Description:
COX15 homolog [Source:RefSeq peptide;Acc:NP_957500]
Human Orthologue:
COX15
Human Description:
COX15 homolog, cytochrome c oxidase assembly protein (yeast) [Source:HGNC Symbol;Acc:2263]
Mouse Orthologue:
Cox15
Mouse Description:
COX15 homolog, cytochrome c oxidase assembly protein (yeast) Gene [Source:MGI Symbol;Acc:MGI:1920112

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9235 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109737 Nonsense 158 399 4 10
ENSDART00000110737 Nonsense 158 399 4 9
Genomic Location:
Chromosome 13 (position 589990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCATGTGGGGTCGTCTGGTGGGATTAGCTTACATTCTCCCCGCTGCGTA[T/A]TTCTGGAGGAGAGGATACTTCAGCCGCTCCATGAAGACTCGGGTTTTGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mc7e668a