acsl5

Ensembl ID:
ENSDARG00000075931
ZFIN ID:
ZDB-GENE-040912-169
Description:
long-chain-fatty-acid--CoA ligase 5 [Source:RefSeq peptide;Acc:NP_001004599]
Human Orthologue:
ACSL5
Human Description:
acyl-CoA synthetase long-chain family member 5 [Source:HGNC Symbol;Acc:16526]
Mouse Orthologue:
Acsl5
Mouse Description:
acyl-CoA synthetase long-chain family member 5 Gene [Source:MGI Symbol;Acc:MGI:1919129]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6263 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043887 Essential Splice Site None 681 1 22
Genomic Location:
Chromosome 12 (position 33144330)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTACACACTGGACACCTGCAGGTTACAAAGCTTTTAGCATCCTGAAAG[G/A]TACTAGCTTTCATTCTGAATTTCATATACATGGCATTGTGCAAAACACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vv58lhas