adamts22

Ensembl ID:
ENSDARG00000075930
ZFIN ID:
ZDB-GENE-070816-3
Human Orthologue:
ADAMTS2
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 2 [Source:HGNC Symbol;Acc:218]
Mouse Orthologue:
Adamts2
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2 Gene [

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32352 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1626 Nonsense Available for shipment Available now
sa13856 Nonsense Available for shipment Available now
sa29631 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114158 Essential Splice Site 158 1295 3 22
ENSDART00000147203 Essential Splice Site 123 1257 2 21

The following transcripts of ENSDARG00000075930 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31381524)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32580994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACCTGTTTTTGAAAAAGCCTAATCTCTGCCTCTCCTTCAAACCCTTC[A/G]GGCGGGGATGATCCGCGCAGGTCAGGAGGAGTTTTTTATCGAGCCACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114158 Nonsense 592 1295 12 22
ENSDART00000147203 Nonsense 557 1257 11 21

The following transcripts of ENSDARG00000075930 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31316423)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32515893
KASP Assay ID:
554-1567.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAACGGAGGGCGCACTTGTTATGGAAACAACTATGAGTTCCAGTTATG[T/A]AACACGGAGGAGTGCGCAGAAGCCCTGGTGGACTTCAGAGAGGAGCAGTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114158 Nonsense 676 1295 13 22
ENSDART00000147203 Nonsense 641 1257 12 21

The following transcripts of ENSDARG00000075930 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31303732)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32503202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCGCTGTTCCTACAAAGACCCCTACAGCGTGTGTGTKCGTGGAGAGTG[T/A]GAGGTAAAGGTTATTCAAACACACCCATCCCTCCAGTTCATCCTCCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114158 Essential Splice Site 1035 1295 21 22
ENSDART00000147203 Essential Splice Site 997 1257 20 21

The following transcripts of ENSDARG00000075930 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31287804)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32487274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCTCTCCAGAGCAGACCCAGAGTTCCCGGCACCAAAGATCTCCTCAA[G/A]TAAACGTCCCGTTTCCAGTCATCAGCCTGCCGTGTGCTGCATGGCCGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link