si:dkey-219c10.4

Ensembl ID:
ENSDARG00000075929
ZFIN ID:
ZDB-GENE-081105-151
Description:
Novel protein similar to vertebrate phosphodiesterase 9A (PDE9A) [Source:UniProtKB/TrEMBL;Acc:A8WHZ6
Human Orthologue:
PDE9A
Human Description:
phosphodiesterase 9A [Source:HGNC Symbol;Acc:8795]
Mouse Orthologue:
Pde9a
Mouse Description:
phosphodiesterase 9A Gene [Source:MGI Symbol;Acc:MGI:1277179]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41482 Nonsense Mutation detected in F1 DNA During 2017
sa34704 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113705 Nonsense 80 342 3 10
ENSDART00000134759 Nonsense 241 514 7 14
Genomic Location (Zv9):
Chromosome 9 (position 39202034)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38339930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATCTCCACGTTCAACATCGAGCCGGATGTGCTGCAGCAGTTTCTTTA[T/A]GAAGTGTACAGACGCTACAACAACATCCCCTTCCACAACTTCAAGCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113705 Essential Splice Site 104 342 4 10
ENSDART00000134759 Essential Splice Site 265 514 8 14
Genomic Location (Zv9):
Chromosome 9 (position 39199345)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38337241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGTAAAAAAAGTTCTGACCGCTAATATCTGGGTCCATTTGTTTGTC[A/T]GATGTATGGGCTCATATGGCTAACAGATCTCAGAAGCAAGATTGACAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link