IGFN1 (2 of 3)

Ensembl ID:
ENSDARG00000075926
Description:
immunoglobulin-like and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:24607]
Human Orthologue:
IGFN1
Human Description:
immunoglobulin-like and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:24607]
Mouse Orthologue:
Igfn1
Mouse Description:
immunoglobulin-like and fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:304

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13347 Nonsense Available for shipment Available now
sa33955 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114607 Nonsense 360 1260 6 18
Genomic Location (Zv9):
Chromosome 6 (position 46692496)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46753430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGCTGCCAGGAAGGCTCAARAAGAGCAAGATGAGGCAGCCAAGAGGT[C/A]GCAAGCTGAAAGAGATGAAGCGGCCCGGAGAGCTCAGGCTGAAAGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114607 Nonsense 794 1260 11 18
Genomic Location (Zv9):
Chromosome 6 (position 46688632)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46749566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCTCCAACACTGTAGGAGGCAGTATCATTGGCTACAATGTGGAAAAA[C/T]GAAAAAAGGGCAGCAATTTTTGGAGTCAAGCAAACCTAAAAGATGAACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link