IGFN1 (2 of 3)

Ensembl ID:
ENSDARG00000075926
Description:
immunoglobulin-like and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:24607]
Human Orthologue:
IGFN1
Human Description:
immunoglobulin-like and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:24607]
Mouse Orthologue:
Igfn1
Mouse Description:
immunoglobulin-like and fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:304

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44643 Nonsense Mutation detected in F1 DNA During 2017
sa13347 Nonsense Available for shipment Available now
sa33955 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114607 Nonsense 249 1260 5 18
Genomic Location (Zv9):
Chromosome 6 (position 46695512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGGAGTCTATTCGGCTATTGCTGGTCTCAGATCAAGCCAGGGGACTT[T/A]GGATGTGGAAGGTAAGCTTTTTTGGTTTATTTATTTTTTTAAGTACTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114607 Nonsense 360 1260 6 18
Genomic Location (Zv9):
Chromosome 6 (position 46692496)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46753430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGCTGCCAGGAAGGCTCAARAAGAGCAAGATGAGGCAGCCAAGAGGT[C/A]GCAAGCTGAAAGAGATGAAGCGGCCCGGAGAGCTCAGGCTGAAAGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114607 Nonsense 794 1260 11 18
Genomic Location (Zv9):
Chromosome 6 (position 46688632)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46749566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCTCCAACACTGTAGGAGGCAGTATCATTGGCTACAATGTGGAAAAA[C/T]GAAAAAAGGGCAGCAATTTTTGGAGTCAAGCAAACCTAAAAGATGAACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link