si:ch1073-179p4.3

Ensembl ID:
ENSDARG00000075923
ZFIN ID:
ZDB-GENE-040914-66
Description:
Novel protein similar to vertebrate thioredoxin reductase 2 (TXNRD2) [Source:UniProtKB/TrEMBL;Acc:B8
Human Orthologue:
TXNRD2
Human Description:
thioredoxin reductase 2 [Source:HGNC Symbol;Acc:18155]
Mouse Orthologue:
Txnrd2
Mouse Description:
thioredoxin reductase 2 Gene [Source:MGI Symbol;Acc:MGI:1347023]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20364 Essential Splice Site Available for shipment Available now
sa40377 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017
sa8420 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110987 Essential Splice Site 130 503 5 17
ENSDART00000133455 Essential Splice Site 143 309 5 11
Genomic Location (Zv9):
Chromosome 5 (position 17117591)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14846245
KASP Assay ID:
2259-5546.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATGTTAGGTCTCTAAACTGGGGTCACAGAGTTCAACTACAAGACAAG[T/C]AAGTTTAACCATTAAAACAACATGAACATGAATCTTTTATGGTTTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110987 Essential Splice Site 178 503 7 17
ENSDART00000133455 Splice Site None 309 None 11
Genomic Location (Zv9):
Chromosome 5 (position 17115797)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14844451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACATTCTGTTAGCTACTGGTGGACGGCCAAAGTACCCTACACATGTAA[G/A]TGTGTGTGTGTGTGCGTGCGTGTGCGCGAGCACCAGTGCAGGCGGGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110987 Essential Splice Site 463 503 None 17
ENSDART00000133455   None 309 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 17015823)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14811691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGCCGAACGCTGGTGAAGTCACACAGGGCTTTGCTTTGGGCTTCCAG[T/C]ACGTTCCRCACRTCTCTGTAAACTTGCACATGATGMTGGGCTGGAATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link