si:ch73-70k4.1

Ensembl ID:
ENSDARG00000075915
ZFIN ID:
ZDB-GENE-030131-3788
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JM47]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7127 Nonsense Mutation detected in F1 DNA During 2017
sa21244 Nonsense Available for shipment Available now
sa41167 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109367 Nonsense 119 574 3 4
ENSDART00000147760 Nonsense 129 176 3 3
Genomic Location (Zv9):
Chromosome 8 (position 18054288)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17499176
KASP Assay ID:
554-4484.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAATCTCCTGTTCAAACAKTRAGTGACTGGAGATGGTGCAATGGAAAY[A/T]AAGATGTAAATCCACCTCCKGGTCTGCCAGCTCCATCATTCCTTGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109367 Nonsense 180 574 3 4
ENSDART00000147760   None 176 None 3
Genomic Location (Zv9):
Chromosome 8 (position 18054473)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17499361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAAGAGAAACATGCATCTTCACCTGATGGAGACAGTGTGCCAGTATG[C/A]AGTACACAAACTACTCAGCAGCGCAAACTAGATGATGGAGTCAACTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109367 Nonsense 362 574 3 4
ENSDART00000147760   None 176 None 3
Genomic Location (Zv9):
Chromosome 8 (position 18055017)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17499905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTAGTACTGGGAACAAAATCTGGAGCAAGTGGATCTGGATTAGTACTG[G/T]GAACAAAATCTGGAGCAAGTGGATCTGGATTAGTACTGGGAGCAAAATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link