si:ch211-120k19.4

Ensembl ID:
ENSDARG00000075914
ZFIN ID:
ZDB-GENE-100922-48
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9JTH7]
Human Orthologue:
KCNJ14
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 14 [Source:HGNC Symbol;Acc:6260]
Mouse Orthologue:
Kcnj14
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 14 Gene [Source:MGI Symbol;Acc:MGI:238482

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36083 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108691 Nonsense 289 483 1 3
Genomic Location (Zv9):
Chromosome 16 (position 18889345)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16919668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGGGAAACTTGCGTAAGAGCCACCTGGTGGAGGCTCATGTTCGAGCA[C/T]AGCTACTTAAGGTTAGTGAGTCTTTTTCAATTTATTACTTTTAATGTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link