AGAP3 (1 of 2)

Ensembl ID:
ENSDARG00000075908
Description:
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:16923]
Human Orthologue:
AGAP3
Human Description:
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:16923]
Mouse Orthologue:
Agap3
Mouse Description:
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 Gene [Source:MGI Symbol;Acc:MGI:2183446]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15259 Nonsense Available for shipment Available now
sa13786 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112710 Nonsense 304 326 5 5
ENSDART00000112710 Nonsense 304 326 5 5
Genomic Location:
Chromosome 24 (position 35412680)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACGGCTGTCCTGCTGAAGGYGGCGCTTTATCCACACCCACAGCCACA[C/T]GACACAATCCCAACATCAACAACAACAACGGCCAGTGTGCAGAGCTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112710 Nonsense 304 326 5 5
ENSDART00000112710 Nonsense 304 326 5 5
Genomic Location:
Chromosome 24 (position 35412680)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACGGCTGTCCTGCTGAAGGYGGCGCTTTATCCACACCCACAGCCACA[C/T]GACACAATCCCAACATCAACAACAACAACGGCCAGTGTGCAGAGCTCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jf2fa7u6