LOC100332462

Ensembl ID:
ENSDARG00000075907
Human Orthologue:
KIAA1107
Human Description:
KIAA1107 [Source:HGNC Symbol;Acc:29192]
Mouse Orthologue:
A830010M20Rik
Mouse Description:
RIKEN cDNA A830010M20 gene Gene [Source:MGI Symbol;Acc:MGI:2445097]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20685 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20684 Nonsense Mutation detected in F1 DNA During 2016
sa33846 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112392 Essential Splice Site 776 1573 17 18
Genomic Location (Zv9):
Chromosome 6 (position 20369292)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24057217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTAATAGAAATGTCTTTAATATTGTCCTCTTTGTTTTGTTTTTTAAAC[A/T]GCTTCATCCAGACTTGGCTCAACTCTTAGTTCTAGCAAGCCTGCCTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112392 Nonsense 802 1573 17 18
Genomic Location (Zv9):
Chromosome 6 (position 20369213)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24057138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTAGCAAGCCTGCCTTGCCAAGAAAAGAGGTAGAGAAAGATATATCT[A/T]AACCTTCTACTATTAAGAAGACAACAAAAGCTATCTCTGAGTCAAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112392 Nonsense 1371 1573 17 18
Genomic Location (Zv9):
Chromosome 6 (position 20367506)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24055431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGTCACCTGGACCTTCGACTGGCAGAACAATATGGCAATCCCCAGGCC[A/T]AACATAAAGACAGCAGAAAAGCTGAATTGCGACTAGACTTACCCGAGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link