LOC100332462

Ensembl ID:
ENSDARG00000075907
Human Orthologue:
KIAA1107
Human Description:
KIAA1107 [Source:HGNC Symbol;Acc:29192]
Mouse Orthologue:
A830010M20Rik
Mouse Description:
RIKEN cDNA A830010M20 gene Gene [Source:MGI Symbol;Acc:MGI:2445097]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20685 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20684 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112392 Essential Splice Site 776 1573 17 18
Genomic Location:
Chromosome 6 (position 20369292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTAATAGAAATGTCTTTAATATTGTCCTCTTTGTTTTGTTTTTTAAAC[A/T]GCTTCATCCAGACTTGGCTCAACTCTTAGTTCTAGCAAGCCTGCCTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112392 Nonsense 802 1573 17 18
Genomic Location:
Chromosome 6 (position 20369213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTAGCAAGCCTGCCTTGCCAAGAAAAGAGGTAGAGAAAGATATATCT[A/T]AACCTTCTACTATTAAGAAGACAACAAAAGCTATCTCTGAGTCAAGGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a1gxkgtt