LOC558824

Ensembl ID:
ENSDARG00000075906
Human Orthologue:
ADAD2
Human Description:
adenosine deaminase domain containing 2 [Source:HGNC Symbol;Acc:30714]
Mouse Orthologue:
Adad2
Mouse Description:
adenosine deaminase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1923023]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9821 Essential Splice Site Available for shipment Available now
sa40884 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108997 Essential Splice Site 139 517 2 8
Genomic Location (Zv9):
Chromosome 7 (position 26040459)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24602211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTACATKATGCTKACTWTTACTTTTGTTTAAAACTCTCCTTGCTCTTAC[A/C]GTGAAGTTCGCAGACTGGCACAAAAATCGCGTAACAGCTTTGTGTACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108997 Nonsense 497 517 8 8
Genomic Location (Zv9):
Chromosome 7 (position 26030193)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24591945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAGATGGCTGCCCAGTTGTATCAGGAGACAAAGACTCAAGTCAACATG[C/T]AATTCTTGACCAATAATGCTGGACCGTGGAACTCCAAACACTTGGTAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link