LOC558824

Ensembl ID:
ENSDARG00000075906
Human Orthologue:
ADAD2
Human Description:
adenosine deaminase domain containing 2 [Source:HGNC Symbol;Acc:30714]
Mouse Orthologue:
Adad2
Mouse Description:
adenosine deaminase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1923023]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9821 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108997 Essential Splice Site 139 517 2 8
Genomic Location:
Chromosome 7 (position 26040459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTACATKATGCTKACTWTTACTTTTGTTTAAAACTCTCCTTGCTCTTAC[A/C]GTGAAGTTCGCAGACTGGCACAAAAATCGCGTAACAGCTTTGTGTACTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5eamqz5f