ENSDARG00000075905

Ensembl ID:
ENSDARG00000075905
Human Orthologue:
TGFBRAP1
Human Description:
transforming growth factor, beta receptor associated protein 1 [Source:HGNC Symbol;Acc:16836]
Mouse Orthologue:
Tgfbrap1
Mouse Description:
transforming growth factor, beta receptor associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:24474

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9094 Nonsense Mutation detected in F1 DNA During 2014
sa14167 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110272 Nonsense 317 456 6 7
Genomic Location:
Chromosome 17 (position 15425227)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAGACCAGCAGGCTGCTGAATGCTACTGTTGGAGGACCTCTGCTGGA[C/T]GAGACAAGAAGTTCACGCAGACCATATTTCTCACTYTACTACAAATCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110272 Nonsense 435 456 7 7
Genomic Location:
Chromosome 17 (position 15422353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACAGAGGATGTGTTTGCCATTYATGCCAGAAACGTCTTACTGGAGCC[G/T]AGTTCCTGCGCAGGCCGACAGGAGAGCTGACACACATAACCTGTCATAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • AIDS: Genomewide association study of a rapid progression cohort identifies new susceptibility alleles for AIDS (ANRS Genomewide Association Study 03). (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6v2ofovt