rfx1b

Ensembl ID:
ENSDARG00000075904
ZFIN ID:
ZDB-GENE-041008-101
Human Orthologue:
RFX1
Human Description:
regulatory factor X, 1 (influences HLA class II expression) [Source:HGNC Symbol;Acc:9982]
Mouse Orthologue:
Rfx1
Mouse Description:
regulatory factor X, 1 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:105982]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39704 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005646 Nonsense 312 821 6 17
Genomic Location (Zv9):
Chromosome 1 (position 54665402)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53438905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGTAAGTCTTCCTCGCTGTACTCTATACTGTCATTACCTCCTGCACTG[C/A]CAGCAGACCAAACTGGAACCCGTGAACGCCGCTTCCTTCGGGAAACTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link