ENSDARG00000075902

Ensembl ID:
ENSDARG00000075902
Human Orthologues:
C16orf5, LITAF
Human Descriptions:
chromosome 16 open reading frame 5 [Source:HGNC Symbol;Acc:13234]
lipopolysaccharide-induced TNF factor [Source:HGNC Symbol;Acc:16841]
Mouse Orthologues:
5730403B10Rik, Litaf
Mouse Descriptions:
LPS-induced TN factor Gene [Source:MGI Symbol;Acc:MGI:1929512]
RIKEN cDNA 5730403B10 gene Gene [Source:MGI Symbol;Acc:MGI:1913876]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17272 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109210 Nonsense 194 204 5 5
Genomic Location:
Chromosome 12 (position 21156376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTTCTGTTTGAATCGCTTCRAAGATGTCGCCCACARTTGCCCGTCCTG[C/A]AACAAAGAAATCTGTGCAGTAAACAGGATTTAAAACAGAGTAAAATCTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sm6ijv3b